Summary of papers I have read today

[kSNP v1] K-mers can be used to find single nucleotide polymorphisms.
Gardner, S. N. and T. Slezak (2010). Scalable SNP analyses of 100+ bacterial or viral genomes. J Forensic Res 1, 107.
Summary (from my understanding)
:
1. Enumerate k-mers
2. Find k-mers with a varying central letter central
  example: CACCGTTCAAAGACATTAAATCTTTACAAGC and CACCGTTCAAAGACAGTAAATCTTTACAAGC
3. Align varying k-mers to reference to get coordinates
4. Enjoy



[kSNP v2] An new method (in Perl) discovers variations using an alignment-free variation discovery using k-mers
   


Sequencing highlights variations unseen by conventional methods for the 2011 European E. coli O104:H4 outbreak.
Grad, Y. H., M. Lipsitch, M. Feldgarden, H. M. Arachchi, G. C. Cerqueira, M. FitzGerald, P. Godfrey, B. J. Haas, C. I. Murphy, C. Russ, S. Sykes, B. J. Walker, J. R. Wortman, S. Young, Q. Zeng, A. Abouelleil, J. Bochicchio, S. Chauvin, T. DeSmet, S. Gujja, C. McCowan, A. Montmayeur, S. Steelman, J. Frimodt-Møller, A. M. Petersen, C. Struve, K. A. Krogfelt, E. Bingen, F.-X. Weill, E. S. Lander, C. Nusbaum, B. W. Birren, D. T. Hung, and W. P. Hanage (2012, February). Genomic epidemiology of the escherichia coli O104:H4 outbreaks in europe, 2011. Proceedings of the National Academy of Sciences  109 (8), 3065-3070.




Peptide sequencing shows that RNA editing occurs in the liver of SHR (Spontaneously hypertensive rat) rats.

Low, T. Y. Y., S. van Heesch, H. van den Toorn, P. Giansanti, A. Cristobal, P. Toonen, S. Schafer, N. Hübner, B. van Breukelen, S. Mohammed, E. Cuppen, A. J. Heck, and V. Guryev (2013, November). Quantitative and qualitative proteome characteristics extracted from In-Depth integrated genomics and proteomics analysis. Cell reports.

Comments

Popular posts from this blog

Learning to solve the example 1 of puzzle 3aa6fb7a in the ARC prize

The source code of SOAPdenovo2 sits in the shadows

The Thorium actor engine is operational now, we can start to work on actor applications for metagenomics