Posts

Showing posts from December, 2013

Summary of papers I have read today

[kSNP v1] K-mers can be used to find single nucleotide polymorphisms. Gardner, S. N. and T. Slezak (2010). Scalable SNP analyses of 100+ bacterial or viral genomes.J Forensic Res1, 107. Summary (from my understanding)
:
1. Enumerate k-mers
2. Find k-mers with a varying central letter central
  example: CACCGTTCAAAGACATTAAATCTTTACAAGC and CACCGTTCAAAGACAGTAAATCTTTACAAGC
3. Align varying k-mers to reference to get coordinates
4. Enjoy



[kSNP v2] An new method (in Perl) discovers variations using an alignment-free variation discovery using k-mers Gardner, S. N. and B. G. Hall (2013, December). When Whole-Genome alignments just won't work: kSNP v2 software for Alignment-Free SNP discovery and phylogenetics of hundreds of microbial genomes.PLoS ONE8 (12), e81760+. Code: http://sourceforge.net/projects/ksnp/

Sequencing highlights variations unseen by conventional methods for the 2011 European E. coli O104:H4 outbreak. Grad, Y. H., M. Lipsitch, M. Feldgarden, H. M. Arachchi, G. C. Cerqu…