Summary of papers I have read today

-
[kSNP v1] K-mers can be used to find single nucleotide polymorphisms.
Gardner, S. N. and T. Slezak (2010). Scalable SNP analyses of 100+ bacterial or viral genomes. J Forensic Res 1, 107.
Summary (from my understanding)
:
1. Enumerate k-mers
2. Find k-mers with a varying central letter central
  example: CACCGTTCAAAGACATTAAATCTTTACAAGC and CACCGTTCAAAGACAGTAAATCTTTACAAGC
3. Align varying k-mers to reference to get coordinates
4. Enjoy



[kSNP v2] An new method (in Perl) discovers variations using an alignment-free variation discovery using k-mers
   


Sequencing highlights variations unseen by conventional methods for the 2011 European E. coli O104:H4 outbreak.
Grad, Y. H., M. Lipsitch, M. Feldgarden, H. M. Arachchi, G. C. Cerqueira, M. FitzGerald, P. Godfrey, B. J. Haas, C. I. Murphy, C. Russ, S. Sykes, B. J. Walker, J. R. Wortman, S. Young, Q. Zeng, A. Abouelleil, J. Bochicchio, S. Chauvin, T. DeSmet, S. Gujja, C. McCowan, A. Montmayeur, S. Steelman, J. Frimodt-Møller, A. M. Petersen, C. Struve, K. A. Krogfelt, E. Bingen, F.-X. Weill, E. S. Lander, C. Nusbaum, B. W. Birren, D. T. Hung, and W. P. Hanage (2012, February). Genomic epidemiology of the escherichia coli O104:H4 outbreaks in europe, 2011. Proceedings of the National Academy of Sciences  109 (8), 3065-3070.




Peptide sequencing shows that RNA editing occurs in the liver of SHR (Spontaneously hypertensive rat) rats.

Low, T. Y. Y., S. van Heesch, H. van den Toorn, P. Giansanti, A. Cristobal, P. Toonen, S. Schafer, N. Hübner, B. van Breukelen, S. Mohammed, E. Cuppen, A. J. Heck, and V. Guryev (2013, November). Quantitative and qualitative proteome characteristics extracted from In-Depth integrated genomics and proteomics analysis. Cell reports.

Comments

Post a Comment

Popular posts from this blog

A survey of the burgeoning industry of cloud genomics

-
Image
I like lists. Here is a list of companies in the cloud genomics industry. Table 1: Companies acting in the industry of cloud genomics. The list is in no particular order. Company Products People Founded Link GenoSpace, LLC - GenoSpace platform - John Quackenbush (CEO) 2011 https://www.genospace.com/ DNAnexus, Inc. - DNAnexus Platform - DNAnexus Platform SDK (a.k.a. dx-toolkit) - Serafim Batzoglou (co-founder) - Andreas Sundquist (co-founder and CTO) - a bunch of other famous people in the field 2009 https://dnanexus.com/ Seven Bridges Genomics, Inc. - IGOR - IGOR Python SDK - Igor Bogicevic (CTO) 2009 https://www.sbgenomics.com/ BGI - EasyGenomics - Xing Xu (Senior Product Manager) Introduced in 2012 https://www.easygenomics.com/ Illumina, Inc. - BaseSpace™ - BaseSpace API - Alex Dickinson (SVP of Cloud Genomics) Introduced in 2011 https://basespace.illumina.com/ Era7 Information Technologies SLU - BG7...
Read more

Generating neural machine instructions for multi-head attention

-
  An animal can do training and inference every day of its existence until the day of its death. A forward pass is all you need.   Here is the current model configuration that I use for multi-head attention:         let sequence_length = 6;         let vocab_size = 20;         let n_embd = 64;         let num_heads = 8; You can see the full model here: https://github.com/sebhtml/novigrad/blob/8df6192829edd9cda3a221e12affa770fbda2a1b/src/models/mega_man_attention.rs The struct uses Embedding, MultiHeadAttention, Linear, Softmax: struct MegaManAttentionModel {     input_shape: Vec<usize>,     output_shape: Vec<usize>,     vocab_size: usize,     sequence_length: usize,     embedding: Embedding,     multi_head_attention: MultiHeadAttention, ...
Read more

Adding ZVOL VIRTIO disks to a guest running on a host with the FreeBSD BHYVE hypervisor

-
On atlantis.domain (my FreeBSD BHYVE hypervisor host), I use these commands: Install FreeBSD on a 10G disk. vm create -s 10G guestname   vm install FreeBSD-12.1-RELEASE-amd64-memstick.img vm console guestname Add 8 30GB zvol-based disks vm add -d disk -t zvol -s 30G guestname vm add -d disk -t zvol -s 30G guestname vm add -d disk -t zvol -s 30G guestname vm add -d disk -t zvol -s 30G guestname vm add -d disk -t zvol -s 30G guestname vm add -d disk -t zvol -s 30G guestname vm add -d disk -t zvol -s 30G guestname vm add -d disk -t zvol -s 30G guestname You will need to do vm poweroff guestname vm start guestname because the guest does not seem to see the 8 30GB without power cycling. (rebooting won't work) *** If you want the boot disk (the one create by "vm create") to be a zvol, you must edit the template: root@atlantis:~ # zfs snapshot tank/vm-bhyve@2020-06-11-2145 root@atlantis:~ # mount -t zfs tank/vm-bhyve@2020-06-11-2145 /tank/vm-bhyve@2020-06-11-2145 r...
Read more